USDA Backs Production of Rice With Human Genes

[Jcrowley]

USDA Backs Production of Rice With Human Genes
By Rick Weiss
Washington Post Staff Writer
Friday, March 2, 2007; A02

The Agriculture Department has given a preliminary green light for the first commercial production of a food crop engineered to contain human genes, reigniting fears that biomedically potent substances in high-tech plants could escape and turn up in other foods.

The plan, confirmed yesterday by the California biotechnology company leading the effort, calls for large-scale cultivation in Kansas of rice that produces human immune system proteins in its seeds.

The proteins are to be extracted for use as an anti-diarrhea medicine and might be added to health foods such as yogurt and granola bars.

"We can really help children with diarrhea get better faster. That is the idea," said Scott E. Deeter, president and chief executive of Sacramento-based Ventria Bioscience, emphasizing that a host of protections should keep the engineered plants and their seeds from escaping into surrounding fields.

http://www.washingtonpost.com/wp-dyn/content/article/2007/03/01/AR2007030101495_pf.html

Helping the children as cover just as it is with the "feeding the world" mantra of the Gene Giants.

[Ian David]

1. Oh... I thought...

It was about TIME Condi got some human genes...

[corkhead]

2. Just like Chimpy predicted, Human-Rice Hybrids

[nebenaube]

3. 2010 News Flash

Immunologist today are still baffled in regard to the recent increase in the prevelance of Auto-immune disorders rose from 18 million people in the population to a staggering 60% of the total population... News at 10...

[Buzz Clik]

26. Newsflash! Paranoia about the unknown continues to scare human beings.

"Hey, I know it's irrational, but it scares me. I made mom check under the bed for monsters when I was a kid. Now I'm afraid of GMOs."

[nebenaube]

69. In two words...

**** you...

[Buzz Clik]

77. Not exactly a scientific rebuttal, but it will do.

[kestrel91316]

111. Ignorance of the Law of Unintended Consequences never

fails to astonish me.

It's terribly naive to be blind to the possibilities for harm, especially given how problematic GE crops have already been.

[Morgana LaFey]

120. Exactly right and thanks for saying it

The human race hasn't done such a hot job of playing God up to now -- or fooling successfully with Mothe Nature, this is for sure not something I'm interested in seeing happen.

And ya know what else? I call it "patriarchy run amok" when the stupid, testosterone-poisoned men who run things insist on doing something foolish and unproven just because they can. There are things which modern technology might enable us to do that we ought to stay far, far away from actually doing, and THIS is just one of them.

[donsu]

4. NO NO NO NO NO

and again NO

between global warming ruining crops and the food barons ruining food - we humans don't stand a chance.

[Canuckistanian]

5. Attack of the Killer Basmati?

And have they done decades of study to make sure there are no adverse effects? Will it contaminate conventional crops? Can it be safely eradicated if found to be harmful?

None of those questions were asked in the case of genetically modified canola.

[gravity]

7. GM crops are tested for all adverse effects

[Eurobabe]

9. Are you serious?

:wtf:

[Canuckistanian]

16. Really? Every possibility is covered?

Impact on insects and wildlife? Soil nutrient depletion? Long term health effects? Allergens? Resistance to contaminations such as smut or ergot?

And who guarantees that the tests are done properly? The company? A Bush crony-infested FDA?

I wish I had your confidence.

[Morgana LaFey]

122. I wish NOBODY had his confidence

it's either "bought" (and you KNOW what I mean) or frankly delusional.

[ThomCat]

18. And the test results are published where?

:shrug:

When sheep that eat genetically modified cotton plants die in large numbers, when pollen from genetically modified plants are contaminating other fields and crops, clearly there hasn't been nearly enough safety testing and it hasn't been nearly transparent enough.

[gravity]

35. Here

Food Safety Evaluation of Crops Produced through Biotechnology
Bruce M. Chassy, PhD
University of Illinois, Urbana, Illinois

ABSTRACT

Agricultural biotechnology has been widely adopted in agriculture but is also the focus of controversy. Questions have arisen regarding food and environmental safety. In the US, responsibility for ensuring agricultural and environmental safety is delegated to the USDA and EPA, respectively. The FDA has primary responsibility for food safety, with the exception that the EPA has responsibility for the safety of proteins in plants associated with insect defense mechanisms. The food safety assessment, whether performed by the FDA or the EPA, requires evaluation of the safety of 1) the newly added DNA, 2) the safety of the newly introduced gene product and 3) the overall safety of the balance of the food. A paradigm called "Substantial Equivalence" guides the assessment. The principal food safety issues for new varieties crops are 1) potential toxicity of the newly introduced protein(s), 2) potential changes in allergenicity, 3) changes in nutrient composition, 4) unintended effects giving rise to allergenicity or toxicity and 5) the safety of antibiotic resistance marker-encoded proteins included with the transgene. All of these must be taken in the context of the predicted range of dietary exposures. The evaluation seeks to establish that there is a "reasonable likelihood of safety" and that new varieties are as safe as or safer than crops produced by traditional methods. Indeed, after extensive safety testing and some five years of experience with such crops in the marketplace, there is not a single report that would lead an expert food scientist to question the safety of such transgenic crops now in use.

...

How Is Biotechnology Regulated?

Although the science indicated that no new or different risks were present, new more rigorous regulatory processes are used to assess the food, feed, and environmental safety of crops developed via biotechnology. Regulators, scientists and the industry choose to err on the side of precaution. It is ironic, then, that critics challenge that a more precautionary approach should be taken. There are several excellent websites that describe the regulatory processes in detail <5>. There are nine steps in the United States in the regulatory process <5>:

Biosafety Committee—NIH Biosafety Guidelines
USDA greenhouse approval
USDA field trial authorization
USDA authorization transport for field trials
USDA permission to commercialize
EPA experimental use permit approval
EPA determination of food tolerance or tolerance exemption
EPA product registration
FDA review process

It takes seven to ten years to navigate the regulatory waters, and, in the US, three government agencies—the USDA, EPA and FDA—are involved. There are several public hearings, and there is some opportunity for public input into the process. Opportunity for public input, transparency of process and availability of information could, however, be improved so that there could be no misunderstanding about the nature of the regulatory process. A recent Issues Paper on the regulatory approval process has been published by CAST <5> and is available in hard copy or as a downloadable PDF.

http://www.jacn.org/cgi/content/full/21/suppl_3/166S

[lyonn]

54. FDA, EPA, USDA; you seem to believe these agencies

are reliable. Now this is where I have a problem with any tests they have run, especially since 2001.

[kestrel91316]

116. More proof that the ability to cut and paste does not connote any

level of intellect whatsoever.

[gravity]

123. It was published in a peer reviewed scientific journal

I guess next time I should base my opinion off of more reliable scientific sources like the internet :sarcasm:

[HiFructosePronSyrup]

169. You asked a question, you were provided an answer.

And then you insult him for it?

Talk about no connotation of intellect.

[femmedem]

28. GM: New study shows unborn babies could be harmed

http://news.independent.co.uk/environment/article337253.ece

Women who eat GM foods while pregnant risk endangering their unborn babies, startling new research suggests.

The study - carried out by a leading scientist at the Russian Academy of Sciences - found that more than half of the offspring of rats fed on modified soya died in the first three weeks of life, six times as many as those born to mothers with normal diets. Six times as many were also severely underweight.

The research - which is being prepared for publication - is just one of a clutch of recent studies that are reviving fears that GM food damages human health. Italian research has found that modified soya affected the liver and pancreas of mice. Australia had to abandon a decade-long attempt to develop modified peas when an official study found they caused lung damage.

And last May this newspaper revealed a secret report by the biotech giant Monsanto, which showed that rats fed a diet rich in GM corn had smaller kidneys and higher blood cell counts, suggesting possible damage to their immune systems, than those that ate a similar conventional one.

Headline edited for accuracy.

[WindRavenX]

31. while these studies absolutely need to be taken seriously...

...and have even MORE study done in this area, I didn't read anywhere that human children died from GMOs.

[femmedem]

34. Thanks.

While that's not quite what I said, I updated the headline to clarify. That was sloppy reading on my part.

[WindRavenX]

37. no prob!

I think there's a lot of misunderstanding surrounding this issue, and while I agree 10000% that continuous research needs to be done to understand (in particular, cross-fertilization issues)more of how GMOs impact the environment and gene pools, I also think that most people don't understand how GMOs work and how they can be beneficial.

[TZ]

147. I'm missing something here can you explain?

I really don't even understand how this could be all that useful. Do you understand the motivation? I am guessing that maybe they feel this would be a cheap and quick way to "grow" a drug. It seems like the worst kind of out of control science aka "Jurassic Park:We did it because we can" mentality. But I thought you might know. I am not at all familiar with this field ( no pun intended:-)

[kestrel91316]

114. Link???

:rofl:

[gravity]

118. Post #35

:evilgrin:

[Jcrowley]

136. Could you

please post just a few of those tests?

If there are so many it should be quite simple to put up a few examples you know of.

Thanks in advance.

[kestrel91316]

113. I'm sure the rocket scientists behind this are already salivating at

the prospect of huge legal judgements and settlements from the VICTIMS of genetic pollution a la canola seed in Canada and the Dakotas.

Hell, that's probably half their motivation for proceeding.

[LiberalEsto]

6. Soylent Green

Eat your granola, sweetie, it's got genes from Great-Grandma.

[Initech]

87. Damn, beat me to it!

[tk2kewl]

102. Maybe rice can be engineered to grow hands and pick itself

:silly:

[GreenPartyVoter]

8. Crap. Wish these people would leave food the heck alone.

[shadowknows69]

11. When our reality starts catching up to our science fiction novels

particularly the dystopian ones, can we slam on the brakes a bit? Sp we rice eaters are cannibals now? Thanks. Just engage us unwittingly in one of humanity's oldest taboos. Small price for less diarrhea.

[gravity]

66. Diarrhea is a major cause of death in the 3rd world

Diarrhea death statistics for various regions worldwide:

About 707,000 deaths from diarrheal diseases in Africa 2002 (The World Health Report, WHO, 2004)

About 57,000 deaths from diarrheal diseases in The Americas 2002 (The World Health Report, WHO, 2004)

About 604,000 deaths from diarrheal diseases in South East Asia 2002 (The World Health Report, WHO, 2004)

About 16,000 deaths from diarrheal diseases in Europe 2002 (The World Health Report, WHO, 2004)

About 259,000 deaths from diarrheal diseases in Eastern Mediterranean 2002 (The World Health Report, WHO, 2004)

About 154,000 deaths from diarrheal diseases in Western Pacific 2002 (The World Health Report, WHO, 2004)

[shadowknows69]

85. Yeah, thanks for the guilt trip

I still don't want to eat my cousin in my rice a roni

[HiFructosePronSyrup]

100. Isn't that a bit like saying...

you don't want to have your picture taken, because the camera will steal your soul?

[shadowknows69]

108. Last I checked

there was no genetic engineering going on in the field of photography.

[HiFructosePronSyrup]

115. That's true.

They use soul stealing ectoplasmic spiritualogy.

[shadowknows69]

138. lol

Call Ghostbusters

[Morgana LaFey]

127. And diarrhea is caused by a deficiency of human genes in the diet?

I don't THINK so.

Let's fix the cause, not create whole new monstrous probably unfixable problems in some misguided idea that we're HELPING. This isn't akin to using a canon to kill a flea, but a nuclear bomb to wipe out a hornet's nest.

GET REAL, PEOPLE.

[Jcrowley]

137. But what are the primary causes of diarrhea?

Look at root causes not Trojan Horses.

And of course the belief that GM anything is going to solve any difficulties other than Monsanto's portfolio and research scientists endless quest for grant money is completely wrongheaded.

The problems with GMO's are many and well-documented.

Remember the vitamin A rice panacea which was and is of course a hoax. Using such mythical and purportedly altruistic PR stunts to push GMO's on the world is the worst form of cynicism.

[HiFructosePronSyrup]

157. Those greedy scientists.

Driving in around in their fancy NIH ferraris.

OOOooo, they make me so mad!

As for the golden rice myth. There was indeed a myth. But it's not what you think.

[Jcrowley]

163. When Public Relations replaces Science

THE "GOLDEN RICE" HOAX -
When Public Relations replaces Science

by Dr. Vandana Shiva

"Golden Rice": A technology for creating Vitamin A deficiency.


Golden rice has been heralded as the miracle cure for malnutrition and hunger of which 800m members of
the human community suffer.Herbicide resistant and toxin producing genetically engineered plants can be objectionable because of their ecological and social costs. But who could possibly object to rice engineered to produce vitamin A, a deficiency found in nearly 3 million children, largely in the Third World?

As remarked by Mary Lou Guerinot, the author of the Commentary on Vitamin A rice in Science, one
can only hope that this application of plant genetic engineering to ameliorate human misery without regard
to short term profit will restore this technology to political acceptability. Unfortunately, Vitamin A rice is a hoax and will bring further dispute to plant genetic engineering where public relations exercises seem to have replaced science in promotion of untested, unproven and unnecessary technology.

The problem is that vitamin A rice will not remove vitamin A deficiency (VAD). It will seriously
aggravate it. It is a technology that fails in its promise. Currently, it is not even known how much vitamin JA the genetically engineered rice will produce. The goal is 33.3% micrograms/100g of rice. Even if this goal is reached after a few years, it will be totally ineffective in removing VAD.

Since the daily average requirement of vitamin A is 750 micrograms of vitamin A and 1 serving contains
30g of rice according to dry weight basis, vitamin A rice would only provide 9.9 micrograms which is
1.32% of the required allowance. Even taking the 100g figure of daily consumption of rice used in the
technology transfer paper would only provide 4.4% of the RDA.

<snip>

Besides creating vitamin A deficiency, vitamin A rice will also create deficiency in other micronutrients
and nutrients. Raw milled rice has a low content of Fat (0.5g/100g). Since fat is necessary for vitamin A
uptake, this will aggravate vitamin A deficiency. It also has only 6.8g/100g of protein, which means less
carrier molecules. It has only 0.7g/100g of iron, which plays a vital role in the conversion of Betacarotene
(precursor of vitamin A found in plant sources) to vitamin A.

Superior Alternatives exist and are effective.

A far more efficient route to removing vitamin A deficiency is biodiversity conservation and propagation
of naturally vitamin A rich plants in agriculture and diets.


Table 1 gives sources rich in vitamin A used commonly in Indian foods.
Source Hindi name/ Content (microgram/100g)
(Amaranth leaves) Chauli saag=266-1,166 -
(Coriander leaves) - Dhania=1,166-1,333
(Cabbage) Bandh gobi=217
(Curry leaves)-Curry patta=1,333
(Drumstick leaves)-Saijan patta1=283
(Fenugreek leaves)-Methi-ka-saag=450
(Radish leaves)-Mooli-ka-saag=750
(Mint)-Pudhina=300
(Spinach)-Palak saag=600
(Carrot)-Gajar=217-434
(Pumpkin (yellow))-Kaddu=100-120
(Mango (ripe))-Aam=500
(Jackfruit)-Kathal=54
(Orange)-Santra=35
(Tomato (ripe))-Tamatar=32
(Milk (cow, buffalo))-Doodh=50-60
(Butter)-Makkhan=720-1,200
(Egg (hen))-Anda=300-400
(Liver (Goat, sheep))-Kalegi=6,600 - 10,000
Cod liver oil=10,000 - 100,000

http://online.sfsu.edu/~rone/GEessays/goldenricehoax.html

Better to actually apply some cogent analysis if you are serious about making a point. No sense in even typing anything if you are saying nothing. Why waste yuor time in such a manner?

So the article above will give you a beginning for further investigation if you are serious about understanding these issues. If not carry on as you please.

[HiFructosePronSyrup]

165. Golden rice is certainly not a hoax.

Furthermore, more recent strains of golden rice produce far more vitamin A than the particular strain Shiva was discussing.

If you want to provide eggs, and carrots, and other vitamin A rich foods to starving children, be my guest.

They're waiting.

[Jcrowley]

168. Could you cite some sources

And are you suggesting that people start eating copious amounts of rice as their sole source of Vitamin A?

The whole GMO business is a hoax, the standard wrong question, wrong answer method. In fact it is just a natural extension of industrial monocrop agriculture which has as quite an ugly track record.

With all those billions spent (wasted) you would think the folk in transgenic manipulation would have something to show for their troubles. After all that's our money.

So please do go into more detail. I need more than your word.

Thanks in advance.

[HiFructosePronSyrup]

171. Sure.

http://www.newscientist.com/article.ns?id=dn7196

"And are you suggesting that people start eating copious amounts of rice as their sole source of Vitamin A?"

Of course not. That's a straw man argument.

"With all those billions spent (wasted) you would think the folk in transgenic manipulation would have something to show for their troubles."

It's their money to spend as they see fit. Saving the lives of millions of foriegn brown people seems like a pretty worthy cause for me. As for something to show, here's a papaya orchard:



It's fallen victim to the Papaya Ringspot Virus. Luckily, there are genetic engineers to the rescue. Guess which ones are genetically engineered.

"Thanks in advance."

You're welcome.

[Jcrowley]

182. Source?

Journal reference: Nature Biotechnology (DOI: 10.1038/nbt1082)

Citing a biotech propaganda rag isn't sufficient. Sorry my friend but I've been involved in this for years and recognize all the tactics even the false imagery.

Even the representatives of biotech companies - such as Steve Smith of Novartis and Paul Rylott of Aventis - have publicly declared that "feeding the world" claims are a myth. Only corporate whores like Jack Gabriels seem still to be spreading this scientifically unjustifiable lie.

"If anyone tells you that GM is going to feed the world, tell them that it is not. To feed the world takes political and financial will" 
Steve Smith, SCIMAC and Novartis (now SYNGENTA), Tittleshall Village Hall public meeting on proposed local GM farm scale trial, 29th March 2000

"GM crops may reduce chemical use and they may increase yields - but GM crops will not feed the world."
Paul Rylott - Aventis - at a public meeting at Low Burnham, Lincs on Wednesday 18th April 2001

Biotech Myth: Biotechnology will feed the world.

Fact: Starvation and malnutrition are very real problems, but they are caused by unequal distribution of wealth, not by food scarcity. According to the United Nations World Food Program, there is currently more than enough food produced to feed everyone on the planet an adequate and healthy diet. The reason that approximately 800 million people go hungry each year is that they don't have access to food by either being able to afford it or grow their own. Biotechnology, by turning living crops into "intellectual property," increases corporate control over food resources and production. Rather than alleviate world hunger, biotechnology is likely to exacerbate it by increasing everybody's dependence on the corporate sector for seeds and the materials.

___________________________________________________________________________________________________________

The truth:
World hunger is not created by lack of food but by poverty and landlessness, which deny people access to food. Industrial agriculture actually increases hunger by raising the cost of farming, by forcing tens of millions of farmers off the land, and by growing primarily high-profit export and luxury crops.

There is no myth about the existence of hunger. It is estimated that nearly 800 million people go hungry each day. And millions live on the brink of disaster, as malnutrition and related illnesses kill as many as 12 million children per year. Famine continues in the 21st century, though few of us are aware of the truly global nature of the problem. In Brazil, 70 million people cannot afford enough to eat, and in India, 200 million go hungry every day. Even in the United States, the world's number one exporter of food, 33 million men, women, and children are considered among the world's hungry.

There is, however, a myth about what is causing this tragic hunger epidemic and what it will take to alleviate it. Industrial agriculture proponents spend millions on advertising campaigns each year claiming that people are starving because there is not enough food to feed the current population, much less a continually growing one. "Guess Who's Coming to Dinner? 10 billion by 2030" proclaimed an old headline on Monsanto's Web page. The company warns of the "growing pressures on the Earth's natural resources to feed more people" and claims that low-technology agriculture "will not produce sufficient crop yield increases to feed the world's burgeoning population." Their answer is pesticide- and technology-intensive agriculture that will produce the maximum output from the land in the shortest amount of time. Global food corporations, they say, will have to serve as "saviors" of the world's hungry.

http://www.alternet.org/story/13900/

One of the biggest myths perpetuated by the biotechnology industry is that genetically engineered crops are likely to provide a solution to world hunger. Companies like ICI Seeds, Britain's largest seeds merchant, proclaim that biotechnology will be the most reliable and environmentally acceptable way to secure the world's food supplies .

Elsewhere, executives from the Monsanto Corporation have gone as far as to promote themselves as part of the solution to the world's food and environmental problems: 'sustainable agriculture is only possible only with biotechnology and imaginative chemistry', they claim in a 1990 article entitled 'Planetary Patriotism'. Similarly, a recent advertisement from Monsanto depicts maize growing in the desert with the caption: "Will it take a miracle to solve the worlds hunger problems?". Implicit in these messages is that to oppose biotechnology is to reject the best hope for a solution to world hunger and to perpetuate the suffering of starving children.

Here are reasons why biotechnology and food security can never be compatible:
- Biotechnology can never be a cure for hunger - Famines are not caused by lack of food but by lack of access to food and alternative sources of income in times of crisis. There are ample reserves of food in the world today yet the numbers of malnourished run into hundreds of millions. Increasing agricultural production (even assuming that this is possible through biotechnology) whilst leaving the structural causes of poverty and hunger unaddressed is a recipe not for feeding the world but for continuing to starve sizable numbers within it.

- Biotechnology creates dependency - Biotechnology goes hand in hand with intensive agriculture, with single crops in large fields. The majority of Third World farmers are small-scale, farming a variety of crops. By switching to genetically engineered seeds they have to change their practices and become dependent on the companies which provide the "package" of seeds, herbicides, fertilizers, irrigation systems, etc. In India, farmers using Monsanto's genetically engineered seeds pay an extra $50 - $65 per acre as a 'technical fee' over and above the price of seed. Farmers who do business with Monsanto must sign a contract stating that they will not buy chemicals from any one else.

http://www.pmac.net/campbell.htm

If you believe s you do I feel quite certain you haven't looked into very deeply or have some other agenda. If that is the case I also am certain my post will have no impact on you and you will not pursue a deeper exploration into this matter. Perhaps some others will come across this.

[femmedem]

191. Excellent post. Thank you. n/t

[Paulie]

181. And the major CAUSE of Diarrhea is...

Is a lack of clean water and sanitation. Eating clean food with dirty water doesn't make you healthy.

From: http://www.who.int/water_sanitation_health/publications/facts2004/en/index.html
Diarrhoea

• 1.8 million people die every year from diarrhoeal diseases (including cholera); 90% are children under 5, mostly in developing countries.
  
• 88% of diarrhoeal disease is attributed to unsafe water supply, inadequate sanitation and hygiene.
  
• Improved water supply reduces diarrhoea morbidity by between 6% to 25%, if severe outcomes are included.
  
• Improved sanitation reduces diarrhoea morbidity by 32%.
  
• Hygiene interventions including hygiene education and promotion of hand washing can lead to a reduction of diarrhoeal cases by up to 45%.
  
• Improvements in drinking-water quality through household water treatment, such as chlorination at point of use, can lead to a reduction of diarrhoea episodes by betweem 35% and 39%.
  

And also from the WHO, where they push re-hydration treatment with oral re-hydration salt solution, because anti-diarrheal medications are NOT an appropriate treatment for disease caused diarrhea, they don't let the body pass the infection out of the body. Re-Hydration is the KEY.

http://www.who.int/child-adolescent-health/New_Publications/CHILD_HEALTH/Pharm/intro.htm

[Jcrowley]

195. That's right

And you'll find the pattern of promoting GMO's based on some faulty reasoning and then that faulty reasoning trumpeted so loudly and often that people who consider themselves intelligent begin to parrot the very same PR that Monsanto spits out without thinking about how patenty absurd is the premise. "Feeding the world", "Curing blindess for third world children", "Reducing pesticides" and now "curing diarrhea. It just goes on and it is all a lie.

The only thing GMO's will ever solve are problems with Monsanto's expiring patents. And that is a solution we can do without.

[Morgana LaFey]

126. That's exacty right too

How the HELL can anyone not see that?

Can't we leave ANYthing sacred and untouched and un-fucked with in this world?

I'm so sick of these hot shots who don't know anything about anything. And yes, anyone who wants to can definitely call me a Luddite. You bet.

[shadowknows69]

144. All I know is if I'm going to be forced to eat anyone?

I'm going to eat the rich.

[Eurobabe]

10. This is CREEPY and WRONG

Something awful comes this way...

[Porcupine]

12. MMMM, human. Yum. That would smell so good cooking......

like those pork rice wraps the chinese make.
:humour:

[blues90]

13. Sure , why not , lets play with mother nature .

And screw everything up for some insane idea that spawned from some mad scientists brain .

[DavidDvorkin]

14. Gives a new meaning to "combination fried rice"

Sprinkle on some GM soy sauce, and you're all set for a balanced meal.

[montanto]

15. Condi has HUMAN genes? No way!

[cascadiance]

93. I guess they're planning an upgrade to the Stepford line soon! :)

Tyrell Corporation would have been proud!

[kiahzero]

17. It's good to see that the Luddite movement is alive and well.

I suppose you all think that what Normon Borlaug did for India was wrong, too, because it was "screwing with Mother Nature."

:eyes:

[ThomCat]

19. As opposed to all of the people with blind faith in

corporate science for profit. Yes, there's nothing like the profit motive to make sure that a product is truly safe. :eyes:

[kiahzero]

22. Strawman.

What a surprise - a complete failure of an argument!

I stand by my statement - the same people complaining about this research would have been complaining about Borlaug's work in India. It's not a rational concern over specific problems, it's a impulsive "don't mess with nature" argument that simply can't be sustained.

[ThomCat]

24. Your OP was an ad hominem attack

not an argument. Anyone who objects to GMOs is apparently a luddite. Talk about strawman arguments. :eyes:

Come back when you grow up.

[Buzz Clik]

30. Perhaps you can provide some reason for all the distrust of GMOs.

Can you give us a list of problems that have emerged that have been documented as attributed to GMOs?

[ThomCat]

39. There were many threads already

about the farmer in Canada who's crops were contaminated by GMO pollen from another field. Montsanto sued him an won because under the law if you have crops that contain their genes you owe them money. Farmers cannot keep seeds from their own harvest to plant next year, even though the harm is Montsanto's fault.

There were the above-mentioned sheep who ate the GMO cotton plants in india and died.

There is the very public uproar about how the contamination of nearby fields cannot be prevented and this is a serious risk to the entire organic food industry, as well as the survival of historic varieties of corn that only exist in small farms.

There have not been any long term tests of the effects of GMO in terms of alergic reactions, toxicity, or other adverse reactions because they haven't been around long enough yet. The tests that have been done haven't seen the light of day, and yet GMOs are getting fast tracked for approval.

We're not talking about adding a trivial or cosmetic change to an existing product. We're changing the genetic structure of things, and the method used to is admitted to be crude. They "shotgun" the genetic material into the seed, which does insert it where it's intended, but also causes other changes elsewhere in the DNA that they don't bother to catalog, examine or monitor. So, in my opinion, any sane person should want this stuff thoroughly tested before it's allowed on the market.

[HiFructosePronSyrup]

46. See, that's the kind of thing we're talking about.

It turns out the farmer's field wasn't contaminated by pollen. He kept the seeds and lied about it. He infringed on their patent. That's old news.

The sheep that died, didn't die from GE cotton. That GE cotton's been tested on sheep and all sorts of other animals. It's perfectly safe. Also old news.

[ThomCat]

51. His field was contaminated.

He kept the seeds anyway because he figured they were his and Montsanto didn't have a right to profit from their mistake. The court decided that he should have destroyed all his seed, and because he didn't Monsanto had a claim on everything he grew.

[HiFructosePronSyrup]

56. No, it wasn't.

He licensed the seeds from monsanto, or got some from some other farmer, and then planted them, infringing on Monsanto's patent, then falsely claimed his field was contaminated.

[ThomCat]

59. No. It went all the way to the Canadian Supreme Court

because he had a strong case, and he had that strong case because he had never used Monsanto seeds.

[HiFructosePronSyrup]

61. Yes.

And the Canadian supreme court sided with Monsanto.

[ThomCat]

72. Yes. They won. The court ruled that they were owed

royalties because the farmer reused his own seed, not because montsanto didn't contaminate his field (they did) but because he didn't then destroy the seed.

So the court ruling basically gave corporations free reign to contaminate fields, and placed all the responsibility on the victims to destroy their seed and start over. All because patent law trumps everything else.

[HiFructosePronSyrup]

83. From a trial judge...

"none of the suggested sources could reasonably explain the concentration or extent of Roundup Ready canola of a commercial quality" ultimately present in Schmeiser's crop."

[kiahzero]

48. That's a patent law problem, not a problem with GM food

Montsanto sued him an won because under the law if you have crops that contain their genes you owe them money. Farmers cannot keep seeds from their own harvest to plant next year, even though the harm is Montsanto's fault.

Patent law isn't a natural thing, and problems in patent law shouldn't obstruct useful research. Instead of attacking GM food, why not attack the legal constructs that are the real problem?

We're not talking about adding a trivial or cosmetic change to an existing product. We're changing the genetic structure of things, and the method used to is admitted to be crude.

The same was true of Borlaug, yet his work on dwarf-wheat is feeding India.

[ThomCat]

58. One example does not certify the entire industry as safe.

And that one example is still be studied.

Yes, feeding people is a vital cause, but it's not a free pass for potentially dangerous science. Do the tests, make the results public, and find a way to prevent contamination.

[Buzz Clik]

55. Your gripe is with Monsanta and their legal practices.

That's not the central theme of the complaints of this thread.

I have no use for large corporations who squeeze family farmers, but GMOs have a very important place in today's world.

[ThomCat]

60. Yes, they may have an important place

but corporations control the science, and they're primary motive is profit. Billions of dollars is a strong incentive to rush products to market. I want to see the testing. I want to see the safety measures. And I want transparency.

[NashVegas]

134. GMOs Importance Is Solely Economic

As a way of inserting a patent-owning middleman between food and food eaters.

GM/GE crops, in those varieties that do have a yield advantage to traditional, such is insignificant. Most yield less.

[Buzz Clik]

151. Bullshit. Unadulterated bullshit. Who feeds you this crap? Why do you buy it?

I really recommend that you study a subject before you jump in.

I'll give you just one example -- but others have been given on this thread already.

In some parts of Africa, sorghum is a staple crop for humans, but changing conditions and plant diseases have devastated the crops. Without GM sorghum (also called milo), these people would be dead from starvation. They are still are destitute, and the people supplying the sorghum to them are NOT corporations and have not made a single dime in profit from this program. Talk to me about the economics of this program. Good luck.

[NashVegas]

187. Right Back At Ya

Not even two months ago South Africa banned even trials of it, because the GM variety could breed with weeds that are relative, leading the weeds to become resistant.

Did you hear there's talk of sorghum being used as a resource for ethanol? Wow, imagine having a patent, should that come to pass!


Oh, and how did that great GM cassava experiment go?

[Buzz Clik]

198. Link.

No link, no credibility.

Give me a link, and we'll carry this further.

[kiahzero]

32. No, not "anyone."

The piss-poor arguments offered in this thread ("It's screwing with Mother Nature"), however, are consistent with being a Luddite.

[ThomCat]

41. And you're offering anything better?

It's nice of you to offer less, and do it insulting. Yes, that contributes a lot. :eyes:

[kiahzero]

53. I'm pointing out the logical fallacies in other people's arguments.

It does contribute, because it explains why these arguments are non-starters and shouldn't be paid any attention. If you'd like to offer better arguments that can be rationally discussed, feel free.

[ThomCat]

68. Your argument for why people shouldn't be paid attention

is no more compelling than "You're all stupid." Which is basically what you said by accusing people of being luddites.

If you'd like to contribute anything that really is an argument that can be discussed rationally then please do.

[HiFructosePronSyrup]

74. Who said anything about not paying attention?

The OP is about how the USDA approved a new strain of rice, and people utterly freaked out.

There's a difference between freaking out, and paying attention.

[kiahzero]

76. I already did... please reread my post.

I suppose you all think that what Normon Borlaug did for India was wrong, too, because it was "screwing with Mother Nature."

Is "dwarf-wheat" bad because it was "screwing with Mother Nature", or is it just new research that's inherently evil?

[ThomCat]

81. Neither.

We've been "screwing with mother nature" for thousands of years. And I don't believe anything is inherently evil.

That doesn't mean this dwarf wheat won't have long term consequences Or that other crops won't have have more, less or different long term consequences.

I don't like the idea of rushing these products to market and assuming they will be safe. If one does prove to be safe that doesn't make it acceptable to rush other products to market on the assumption that they will be safe too.

If one product turns out to have a side effect that's deadly, that product can't be recalled. Once the pollen is out there the product is permanently out there, and it will spread.

[Jcrowley]

164. Here are the answers

You are not making an argument for anything in fact there is no analysis whatsoever in your post. Not of the OP or of any specific example you may have to defend GMO's. So please give reasons why you think GMO's are positive and cite examples/studies/articles etc. Otherwise you cannot be taken seriously by just using the "Luddite" label, by the the way Monsanto avoids discussion this way and it is rather tedious, which is just the time honored technique of name-calling to avoid the issue at hand. Simply by crying "Luddite" one thinks that's the end of discussion and then they avoid the issue by running off.

There are absolutely no good reasons for GMO foods that I've seen so if you know of one convince me. Please tell me the "problems" GMO's are suppose to solve.

In the meantime do you know how much energy goes into the production of GMO's?

You would think with the many billions they've spent so far there would be at least ONE item they could hold up as their grand success. Over the rainbow I guess.

And here are the real answers:

-Ecological agriculture: Alternatives to GE crops consist of ecological systems of agriculture, also loosely referred to as sustainable agriculture. At their core is organic farming, but they also include other variations such as natural farming, biodynamic farming, permaculture, etc.

- Organic/natural farming: One of the most viable options is organic and natural farming, most successfully performed on small plots rather than thousands of acres. Organic sales alone are expected to reach $6 billion by 2001 and to grow 20-25% annually. A Food Marketing Institute study reports that organic and natural foods are available at approximately 73 percent of grocery stores and supermarkets. Of shoppers surveyed in FMI's study, more than 50 percent said they purchase organic or natural foods at least once a month; 35 percent said they actively seek out products that are labeled as "organic"; and 63 percent look for products labeled "natural." Purchase of organic products is highest among consumers between 18 and 29 (31 percent), with a heavier concentration of sales in the West (34 percent), according to the 1998 Fresh Trends Report published by The Packer. (John Fetto, American Demographics, August 1999)

- Crop rotation/intercropping: The dramatic effects of rotations and intercropping on crop health and productivity, as well as of the use of biological control agents on pest regulation have been confirmed repeatedly by scientific research. The problem is that research at public institutions increasingly reflects the interests of private funders at the expense of public good research such as biological control, organic production systems and general agroecological techniques . Civil society must request for more research on alternatives to biotechnology by universities and other public organizations (Krimsky and Wrubel l996).

- Agroecological principles: Yield increases are being achieved by using approaches based on agroecological principles that stress diversity, synergy, recycling and integration; and social processes that stress community participation and empowerment. When agroecological features are optimized, yield enhancement and stability of production are achieved, as well as a series of ecological services such conservation of biodiversity, soil and water restoration and conservation, improved natural pest regulation mechanisms, etc. (See: Rosset, P. l999 The multiple functions and benefits of small farm agriculture in the context of global trade negotiations. Institute for Food and Development Policy, Food First Policy Brief No.4) (See also: Altieri, M.A., P.Rosset and L.A. Thrupp. 1998 . The potential of agroecology to combat hunger in the developing world. 2020 Brief 55. International Food policy research Institute. Washington DC)

- More minerals in organic food: Over a 2 yr period, organically and conventionally grown apples, potatoes, pears, wheat, and sweet corn were purchased in the western suburbs of Chicago and analyzed for mineral content. Four to 15 samples were taken for each food group. On a per-weight basis, average levels of essential minerals were much higher in the organically grown than in the conventionally grown food. The organically grown food averaged 63% higher in calcium, 78% higher in chromium, 73% higher in iron, 118% higher in magnesium, 178% higher in molybdenum, 91% higher in phosphorus, 125% higher in potassium and 60% higher in zinc. The organically raised food averaged 29% lower in mercury than the conventionally raised food. (See: Journal of Applied Nutrition 1993; 45:35-39, "Organic Foods vs. Supermarket Foods: Element Levels")

- IFOAM: At the 12th (1999) annual Scientific Conference of the International Federation of Organic Agriculture Movements (IFOAM), more than 600 delegates from over 60 countries voted unanimously against the use of GMOs in food production and agriculture. The delegates called on all governments and regulatory agencies to immediately ban GE in agriculture and food production since it involves: 1) Negative and irreversible environmental impacts; 2) Release of organisms which cannot be recalled; 3) Removal of the right of choice, both for farmers and consumers; 4) Violation of farmers' fundamental property rights and endangerment of their economic independence; 5) Practices which are incompatible with the principles of sustainable agriculture as defined by IFOAM; 6) Unacceptable threats to human health.

[Bucky]

21. We shall enslave the Luddites and make them bow down before....

the Corn King! Mu, ha, ha.

[Buzz Clik]

27. Thank you. That DEFINITELY needed to be said.

[ThomCat]

45. Why?

[HiFructosePronSyrup]

33. That's an insult to the Luddites.

Luddites were a labor movement, upset about new machines that produced textiles via unskilled laborers. They had something resembling a point.

This is more like Creationism.

[ThomCat]

44. What does a concern for the safety of our food

and the preservation of necessary diversity have to do with creationism?

[HiFructosePronSyrup]

47. If you had a legitimate concern about food safety...

you wouldn't resort to pseudoscience.

[ThomCat]

73. Who's resorting to pseudoscience? Where?

I'm demanding testing and accountability. I'm not willing to simply assume it's safe.

[HiFructosePronSyrup]

75. Just there.

You pretended it hasn't been tested.

[ThomCat]

82. So where are these tests?

I find it hard to believe that long term tests on the safety and environmental impact of a GMO have already been performed on a product that's relatively new. Did they somehow go back in time to get a head start? :eyes:

[HiFructosePronSyrup]

86. Talk to the USDA.

Or is this another gardasil type thing?

They test thoroughly but it's never good enough, because you keep moving back the goal posts?

[ThomCat]

92. The USDA has been well known for advocating for

the corporations they are supposed to regulate. There is a well-known revolving door between the USDA, the FDA, and the corporations.

So I'm sceptical of their decisions unless the tests are public and peer reviewed.

[HiFructosePronSyrup]

95. Ah, so it's a conspiracy theory.

I see.

[ThomCat]

98. No, it's a call for transparency in the name of public safety.

The cozy relationship between corporations and our government agencies is so well known that it's hardly a conspiracy.

[HiFructosePronSyrup]

99. Uh huh.

[Morgana LaFey]

130. No, conspiracy fact, actually

It's VERy well documented and it's been going on for decades now. It can ONLY have increased during this fascist administration.

[appal_jack]

154. "an institutional analysis is not a conspiracy theory"

Bornagain, Kia, et al,

The "luddites" on this thread have presented some compelling reasoning as to why extant studies in the US may be inadequate for establishing the safety of GMO crops. The unfortunate fact of the United States political system of the past few decades is that there has turned an ever-faster revolving door between Federal agencies such as FDA, EPA, and USDA, lobbying firms such as the K St. Project, and "regulated" industries such as Monsanto's & Ventria's GMO efforts. To dismiss this reality as a "conspiracy theory," is willfully ignorant. Very real people, with very real bills to pay, are moving from Federal Agency to high-paying corporate job and back again, especially so under this Republican mal-Administration. So I say again, "an institutional analysis is not a conspiracy theory," (a quote I am borrowing from Chomsky).

I happen to work in the agricultural sciences (I do NOT have a Ph.D., nor am I a lab scientist, but I DO participate in field research, and no, not "just" as a farmer, but also in a professional capacity), and I have seen some troubling leads about the dangers of GMO's. Clearly, Bt Corn (to use one example) is not immediately toxic to humans, or we would have our neighbors keeling over after one bag of Doritos. However, the engineering in that Bt corn causes EVERY cell in that corn plant to protuce Bt naturalyte endotoxin. This naturalyte is thought to be relatively safe for humans, but the safety studies were done long before corn cells were producing it. It's a far cry from an organic farmer spraying with Bt once or twice per crop, and a corn plant producing Bt naturalyte in every cell, for every day of its life.

The environmental fate of the Bt naturalyte being produced by the GMO corn is even more troubling. Though the sprayed form of Bt breaks down quickly in sunlight, how long does it take for the toxin to break down in the soils surrounding GMO corn roots? What happens to all the larvae in the soils near the corn? Bt is toxic to them, and though we may cheer when corn rootworm succombs to GMO Bt toxin, are we just as happy when dozens of other beneficial species die? The troubling studies of monarch larvae dying from GMO corn pollen (which drifts in copious quantities, and often lands on milkweed plants nearby corn fields) should certainly give you pause.

There are many other ways that food, nutrition, and health could be improved besides GMO technology, and most of these are cheaper and more effective. Land tenure issues could be addressed so that 3rd World farmers could diversify, incorporate cover crops into rotations, and hold soils with hedgerows, etc., for just one example. But addressing land tenure and soil conservation issues does not enrich those corporate vice presidents who just left the USDA/EPA/FDA for a 7-figure salaried job. My question is: Why are you defending them and their preferred tools?

-app

[laundry_queen]

186. Why indeed.

Great post. Wish I could recommend just this post.

[appal_jack]

196. Thanks laundry_queen

:hug:
This issue gets me riled, for sure. I have no doubt that some of these companies are willfully dismembering our food web, so that they can charge us for what were once free ecosystem services and fringe-benefits of biodiversity. And for those who would think that such an assertion is more wild-eyed conspiracy, I would encourage them to get back to me after reading of the seed-saving/GMO patent law that the US brought to Iraq with its imperial mission. Theft of the Commons is a long-successful corporate strategy, and GMO technology is one that offers opportunity for thefts a-plenty.

-app

[WindRavenX]

57. it's not an either/or thing

We already have a huge problem with monocultures in the US--there really isn't a lot of stock diversity to begin with, which is a pretty big problem on its own.

Yes, like all things, GMOs can be misused and may cause potential problems, but the benefits, imo, far out-weigh the negatives. GMOs can be used to provide supplimental vitamins and minerals in stock strains for people who may not have access to those essential vitamins on their own; it's a huge problem in developing countries where billions of people are malnourished from lack of simple vitamins.

You can use GMOs selectively---I don't think I've read anything that said they would replace non-GMOs, which would be beyond stupid to do so anyway.

[ThomCat]

79. GMOs replacing non GMOs

The problem is, plants pollenate. How do you control where GMO pollen goes? There have already been cases of organic farms that have their crops contaminated. Now those crops can't be sold as organic and the farmers will lose a lot of money over this.

Once that GMO pollen is in the air, how do you limit how far that genetic modification is going to travel? This is a central problem that has not been addressed and must be resolved.

[WindRavenX]

84. I think I addressed this downthread

There are ways to make them infertile. They're called terminal strains.

[ThomCat]

88. If all GMOs were Terminal Strains I'd be much more likely to approve

of them. At least then, if there are any long term negative effects that particular strain could be discontinued.

[HiFructosePronSyrup]

90. So then you're in favor of "terminator genes?"

:shrug:

[ThomCat]

94. If you're producing a GMO

I think a terminator gene is an absolutely necessary precaution.

[WindRavenX]

91. yeah I agree

That seems like a pretty basic goal.

[Commie Pinko Dirtbag]

63. While I have nothing against GM foods per se (save the patent issue), human genes are a bit too much

Call me irrational if you like.

[HiFructosePronSyrup]

97. Why?

What's so special about human genes?

[Commie Pinko Dirtbag]

119. Rationally, I know it's no different than inserting seaweed genes, but it just tickles my icky bone.

[NashVegas]

112. Norman Borlaugh? The Guy Who Loves Round-up Ready Crop?

Did Borlaugh's own work include gene splicing?

[kiahzero]

117. Here you go

http://en.wikipedia.org/wiki/Norman_Borlaug

[NashVegas]

133. Wow, Great

How is is that he was able to breed (not splice) crops that were so able to thrive and be outrageously bountiful, compared to the regular local supply, while biotech GM/GE crops show no significant benefits in yield or economic benefits to farmers?

[kiahzero]

139. Patent law is a big problem.

It actually serves as a disincentive to technological progress in some fields, and biotech appears to be one of them.

[NashVegas]

143. It Is One Problem of Many

Borlaugh didn't have any hampering to his 1960s/1970s work, and he was able to make his fame and fortune doing it.

If he were to try it today, using patented technology, and he wasn't on the payroll, he'd be sued. If he was on the payroll as a salaried employee, most likely he'd have signed something upon employment stating that any idea he had while in employ would be Monsanto's (or whomever's) intellectual property.

That is not the only issue, but it's probably the most threatening from the standpoints of diversity and public domain / common knowledge.

[kiahzero]

146. Absolutely.

That aspect of intellectual property is one of my interests, and if I end up working as a law professor, it will likely be an area that I work in.

[in_cog_ni_to]

20. Just great! Now we can have a side of human immune protein rice with our big juicy CLONED meat steak

!!!!! This makes me ill. What are we going to eat after they fuck up all of our food sources? Polluted water, cloned meat and HUMAN IMMUNE PROTEIN RICE???? This shit is scary.

[Buzz Clik]

23. Uh huh. And what exactly is this dark plot?

I have witnessed firsthand the feeding of starving people with genetically modified crops where other varieties simply could not grow.

No ulterior motives. Just feeding starving people.

[WindRavenX]

29. that's what I was wondering--why does everything have to be a big conspiracy?

Of course you should approach this issue with caution and be skeptical--but why does everything have to be a conspiracy?

Very basically modified strains of agriculture can prevent basic malnutrition for potentially billions of people.

edit: forgot the 'n' in billions :crazy:

[kiahzero]

96. Because some people see everything that way.

It's easier than thinking rationally.

[HiFructosePronSyrup]

38. G.E. papaya trees resistant to Papaya Ringspot Virus.

Guess which ones are the controls.

[WindRavenX]

42. wow

That's quite dramatic. :wow:

[Jcrowley]

185. It's also a lie

Hawaiian farmers warn Thai farmers about genetically engineered papaya: Don't do it!

A delegation of Hawaiian farmers today met with Thai farmers and community organisations warning Thailand against growing genetically engineered (GE) papaya. In an event organised by Greenpeace, the Hawaiian farmers pointed out that although the previous introduction of GE papaya had been disastrous both economically and environmentally, old promotional arguments are now used in Thailand without sharing the negative evidence.

When GE papaya was introduced 5 years ago they claimed it was a 'solution' to the papaya ringspot virus problem. But instead it has caused serious environmental and economic problems for farmers," said Melanie Bondera, a sustainable agriculture farmer and member of the Hawaii Genetic Engineering Action Network (HIGEAN) on Big Island, Hawaii.

The rejection of GE papaya in overseas markets has been devastating for Hawaiian farmers. The selling price of GE papaya has fallen to 30-40 percent below production costs, and the price that farmers get for their GE papaya is 600 percent lower than the price for organic papaya.

Farmers have also discovered that 'SunUp' GE papaya is more easily infected by new plant fungi and diseases like 'blackspot' fungus. This discovery came 5 years after GE papaya was approved for commercial growing. Now farmers must spray toxic chemical fungicides on their SunUp papaya plants every 10 days.

http://www.greenpeace.org/international/press/releases/hawaiian-farmers-warn-thai-far

"There are practical solutions to ringspot virus that are friendly to the environment and better for farmers. This makes GE papaya totally unnecessary," Biloon said. Biloon has developed an organic system to deal with ringspot virus and is organising training workshops and helping other farmers to introduce ecologically sustainable methods for managing plant diseases like ringspot.

Go here:
http://www.ens-newswire.com/ens/sep2004/2004-09-10-04.asp

Eliminate row cropping monoculture and such wrong-headed insanity as GMO's disappears. That's a big task.

[WindRavenX]

194. monocultures are a huge risk indeed

Regarding the ringspot virus, as I mentioned upstream, it's important to study the impact on the environment--which is probably the most important step to follow. Still, in some areas, it probably still has benefit.

[WindRavenX]

25. I'm all for it

Within reason.

In some cases, it is safe to use genetic elements to modify another organism; problems arise when this is either 1)misused 2)tampered with 3)not controlled.

Golden rice is a great example of how organisms can be modified for great benefit. I also have heard of some strains of corn given genes from a particular bacteria that basically kills insects without needing to use pesticide and other chemicals. Now in some areas this isn't advised because some species of butterfly caterpillars (I think maybe monarchs)feed on the bugs, but in some areas you can use this corn.

Obviously, there are huge problems with new technology. But I believe if we go slowly and examine the impact of the environment in areas where GMOs are going to be used, they can be safely used.

[ThomCat]

49. I would agree with you

if there were really any controls. How do you stop pollen from blowing on the wind? How do you stop any contamination of other fields?

And how do you trust corporations to do the necessary testing unless it's mandated and the results are public?

[WindRavenX]

64. contamination is an issue that needs more research

From what I've seen, they can be controlled with are called terminal strains-- basically, the plants are infertile and bear no fertile seeds or pollen. This has actually been used in practice with designer crops.

Keep in mind testing is always done--and while I am always leery of corporations, I think many people have a very knee-jerk reaction to discrediting anything that is done by them.

[StefanX]

36. We don't NEED to mess with Mother Nature

There are plenty of plants that are just fine already.

We don't need to invent new ones by gene-splicing.

A good website that offers existing seed stocks to help fight hunger:

http://www.echonet.org

The only reasons corporations are meddling with plant genes is greed and ego.

This is like that "golden rice" scam the genetic engineers tried to pull years ago, putting vitamin A into rice. I've got some news for them: there's an easier way to get vitamin A. It's called carrots.

[WindRavenX]

40. oh jesus

The golden rice strain is NOT a scam-- the reason the strain was beneficial was because the local populations had no source of vitamin A, including other veggies.

I'm really sick of people thinking everything is a big ol' scam or conspiracy theory :eyes:

[StefanX]

50. Maybe the word I used "scam" wasn't the most precise

But the general gist is: Why do genetic engineering on rice when you can already get vitamin A from other vegetables such as carrots?

Seems needlessly expensive and risky to me.

Instead of "scam" I could just use a more neutral word like "mistake". I think it's a mistake to use genetic engineering to jam vitamin A into rice, when you can much more easily get it from a carrot.

[WindRavenX]

71. some areas literally cannot grow anything but one crop

That's why saying "just grow carrots!" doesn't always work--there are a LOT of places where you simply cannot grow everything you need for your health. Otherwise, yeah, that would be more practical :)

[HiFructosePronSyrup]

43. Is that an organically grown computer you're typing on?

[StefanX]

62. Yeah

It uses potato chips instead of silicon chips. WTF?

[HiFructosePronSyrup]

70. Everything you do "messes with mother nature"

Of all things one does, genetic engineering has one of the smallest impacts on mother nature.

[StefanX]

199. WFT?!? "genetic engineering has one of the smallest impacts on mother nature"?!?

That has got to be one of the most bizarre statements I've ever heard.

Genetic engineering has the BIGGEST impact of anything on Mother nature.

The smallest impact is selecting seeds and letting pollination produce hybrids (like Mendelyev did).

The BIGGEST impact is when you go in and tinker with chromosomes and DNA.

There is a similar scale of intrusiveness in the material world: at the simplest level, there are PHYSICAL manipulations (eg, chopping wood). Then come CHEMICAL manipulations (eg, burning wood). The most intrusive thing you can do it at the ATOMIC level: fissioning uranium or fusing hydrogen. With a physical manipulation, you're just moving things around. With a chemical manipulation, you're changing molecules into different molecules, eg burning involves oxygen bonding with carbon (or something like that, I'm not sure, but you get the gist). Chemical reactions leave the atoms alone but jiggle the electrons to combine the atoms into different molecules. With atomic reactions, you're poking around in the nucleus, and you can turn uranium into lead.

The least intrusive thing you can do with mother nature is let a bee pollinate a flower and then plant the resulting seeds. The MOST intrusive thing you can do is go in there (like some rank amateur) and start splicing together genes to see what happens. And if you're doing this with genes from a rice plant and a human being -- that's about as freaky as you can get. The whole thing makes me sick to my stomach.

[tex-wyo-dem]

80. Do you eat your computer? n/t

[HiFructosePronSyrup]

89. Not directly.

Computers get used for a few years, then get thrown away, and they sit in landfills and pollute the groundwater with lead and other toxic materials.

Not to mention the environmental impact of manufacturing them, and providing them with electricity.

[tex-wyo-dem]

101. True, point taken...

I don't, however, blame people for being skeptical of the safety of GMOs for the reasons I give in post #78.

Health safety I'm sure is one thing that is quite heavily studied; the health to the environment and how GMOs might affect other organisms (especially those that aren't directly related to the production of crops and, therefore, $$$$) I'm not so sure of.

[HiFructosePronSyrup]

103. Skeptical's one thing.

Being afraid of a strain of rice because it's got a human gene is another.

[brentspeak]

52. Sickening, frightening.

[lyonn]

65. It is interesting that the govt. doesn't mind messing with human

proteins, etc., but draw the line on using any part of a human embryo for research.

[proud patriot]

67. No no no no

um no way !

[tex-wyo-dem]

78. Being in the technology industry myself, I'm not against technological advancement, however...

I think people's fears of GMOs come from lack of confidence in the systems we have in place to fully test out the safety of such things as GMOs and drugs (the USDA, FDA, etc.). Too often shortcuts and blatant oversight, both accidental and intentional, are allowed in favor of monied interests, particularly in this age of neo-con controlled government agencies and corporations policing themselves.

Money trumps everything...

[xxqqqzme]

104. from an administation that

has a problem w/ stem cell research????

[Shallah Kali]

105. Remember Golden Rice with vitamina A? you have to eat 18 LBS a day to get enough A

See: http://www.alternet.org/story/16478

All those millions spent developing something useless. Wouldn't have been a heck of a lot cheaper to provide seeds of foods naturally high in vitamin a such as carrots for several years until it became a normal food crop? You know give a man a fish you feed him for a day, teach him to fish.......

[WindRavenX]

106. they developed other strains that had much higher levels of beta-coratene

The first strain was weak, but not the later ones they developed.

And second, there are some places in the world where other crops simply do not grow.

[HiFructosePronSyrup]

107. Untrue.

With the original strain of golden rice, it would have required two to four lbs. per day to get the amount of USDA recommended vitamin A (never mind the amount required to stave off vitamin A deficiency, which is lower).

Problem's been solved in later strains.

Try growing carrots in a mud paddy.

[kestrel91316]

109. I personally consider this a form of cannibalism.

I wonder what the Jews and Muslims will think of it? And the 7th Day Adventists? Hindus? Jains?

I'll starve before eating this.

[HiFructosePronSyrup]

110. Guess which one's human.

acgtacttacgtacgtatggctattacgtagcgctactggcgttatgcgctagcttagagatattatcggcgctatacgatgctagtcggc
acggggatagcagctagatcgcgtagctagcgatataggctatgcggtatattatattatagcgcgcgatgcagctagtgcgcttcgcgat
agatcgatgcgctagcttacgaggagtacgcgtatgcggtatatatatcggcgagcgcttatcgtaagcgttagcgtatcggagagattct
agagagctcggcgcgcgggtagcggctaaggccttacgata

vs.

acgtacttacgtacgtatggctattacgtagcgctactggcgttatgcgctagcttagagatattatcggcgctatacgatgctagtcggc
acggggatagcagctagatcgcgtagctagcgatataggctatgcggtatattctattatagcgcgcgatgcagctagtgcgcttcgcgat
agatcgatgcgctagcttacgaggagtacgcgtatgcggtatatatatcggcgagcgcttatcgtaagcgttagcgtatcggagagattct
agagagctcggcgcgcgggtagcggctaaggccttacgata

[kestrel91316]

148. Completely irrelevant. It's a matter of personal choice and

religious beliefs.

You probably think it would be cool to sneak pig genes into something Jews and Muslims routinely eat.............

[TZ]

150. to be fair...

in some medical research genetically modified mice are given human genes sometimes in order to get them to react more closely to humans behavior. Mice involved in HIV studies are often modified this way since otherwise they could not contract it. And of course sometimes babboon and pig aortas have been used with some success in aorta transplants and grafting to people. Pigs and humans are very alike physiologically. But thats a little different than eating something with hybrid genes in it I suppose.

[kestrel91316]

192. I am by no means opposed to all genetic engineering. It has

been proven very useful in many cases. I use a couple of genetically engineered live canarypox vectored feline vaccines (rabies and feline leukemia) from Merial which are major safety and effectiveness improvements over previously existing vaccines.

Just don't try to sneak GM crops or animals into my food supply, thank you. And don't even THINK about sticking HUMAN genes into my food.

It's a Pandora's Box, and it's also an ethical thing. I don't do Soylent Green, or anything resembling it.

[HiFructosePronSyrup]

159. There's nothing in the Torah or the Bible or the Koran...

about inserting human or pig genes into rice.

I don't think you're giving Jews or Muslims enough credit.

The issue was discussed years ago with pig insulin. It's not a religious problem.

[kestrel91316]

193. I don't think you give Jews or Muslims enough basic RESPECT.

Try asking THEM what they think about this.

YOU and your corporate friends don't get to force this upon ANYONE. Capisce?

[TZ]

149. okay I will play, I am curious

besides trying to find the difference in the sequences are giving me a headache. What are those the sequences for?

[HiFructosePronSyrup]

156. Actually, I just randomly typed a series of codons.

Then cut and pasted, and changed one codon.

But that's my point. The difference between a human gene and a banana gene is the difference of one letter.

[NashVegas]

121. The #1 Fallacy of GM / GE Crops

Is that they are more profitable to farmers thanks to more abundant crop yields.

A two-year study by University of Nebraska researchers showed that growing herbicide-resistant soybeans actually resulted in lower productivity than that achieved with conventional soybeans. These results confirmed the findings of Dr. Charles Benbrook, the former director of the Board on Agriculture at the National Academy of Sciences. His work looked at more than 8,200 field trials and showed that Roundup Ready seed produced fewer bushels of soybeans than similar natural varieties.

http://mulliganstew.wordpress.com/tag/fatal-harvest/

The above is consistent with research I did early this decade. University study after study confirmed that the few GM/GE crops that did have yield benefits over traditional farming did NOT have significantly higher yields, and most had decreased yields.



As for health claims, GE/GM patent holders use threats, bribes and intimidation to suppress information that runs counter to their claims:

A secret feeding study of Monsanto GM potatoes, conducted in 1998 by the Institute of Nutrition of the Russian Academy of Medical Sciences and suppressed for 8 years, showed that the potatoes did considerable damage to the organs of the rats in the study (1) (2). In comparison the rats in the "control groups" which were fed on normal potatoes or on a non-potato diet were healthier, and had much less organ and tissue damage. This research, fully supported by Monsanto through the provision of the GM potatoes, was conducted at approximately the same time as Arpad Pusztai's research in the Rowett Institute.

http://www.organicconsumers.org/articles/article_4167.cfm

Earlier this decade, when Monsanto used its weight to can a Fox news segment on rGBH milk; the reporters working on the story refused to make it Monsanto-friendly and were fired. When they sued Fox, a court sided with Fox who argued that there was no law stating they had to present the truth.

The truth is, GM/GE foods have no significant benefits for anyone save the biotech corporations and their stockholders.

[gravity]

128. People wouldn't use them

if they weren't more profitable. The free market can take care of that.

[NashVegas]

131. There's Nothing Free About the Market

In my above post, there is mention of a study whose results were suppressed for eight years - what's free market about that?

This is a forced market. The corporate-controlled US government is using its weight and the WTO to force the acceptance of GM foods in nations that want nothing to do with it. Those who refuse to bow face continued sanctions, trade wars and the WTO interference with national sovereignty and local regulations.



Accusing Europe of undercutting efforts to feed starving Africans by blocking the use of genetically modified crops which could 'dramatically' boost productivity, the American administration fired the first missile by formally announcing to launch a complaint with the WTO against the European Union for its five-year ban on approving new biotech crops. This has set the stage for an international showdown over an increasingly controversial issue.

...

The overt and covert machinations to push unhealthy and risky GM foods had actually begun a decade ago. The US has so far opposed the Cartagena Protocol on Biosafety, which has been signed by over 100 countries and was intended to ensure through agreed international rules and regulations that countries have the necessary information to make informed choices about GM foods and crops. With the WTO appearing on the scene, the Cartagena Protocol has become meaningless. Since the Convention on Biological Diversity (CBD) has not been ratified by the US, it is not under any obligation to follow the Biosafety Protocol.


...

The US Senate has passed a Bill "the United States Leadership Against HIV/AIDS, Tuberculosis, and Malaria Act of 2003," (HR 1298)", which in a diplomatic way (calling it as `sense of Congress') links financial aid for combating HIV AIDS with GM food acceptance. Section 104A states that "individuals infected with HIV have higher nutritional requirements than individuals who are not infected with HIV, particularly with respect to the need for protein. Also, there is evidence to suggest that the full benefit of therapy to treat HIV/AIDS may not be achieved in individuals who are malnourished, particularly in pregnant and lactating women."

http://www.zmag.org/content/showarticle.cfm?ItemID=3929


Despite losing its case for a strong WTO mandate on GMOs at the Seattle Ministerial, the US
still uses the WTO to force acceptance of GMOs in the South. Unlike the WTO case against the EU
(delayed for months by moves to gain EU support for the war on Iraq), the US has not hesitated to use the threat of WTO sanctions against developing countries. And its effects have been swift. Lacking the political and economic power of the EU, these countries were forced to revoke GMO restrictions even without the US filing a formal complaint in the WTO. The threat alone was enough – especially since WTO-authorized sanctions could be placed on any exports to the US market.

In Bolivia a resolution banning any food or agricultural products derived from GMO crops was
introduced in January 2001, but pressure from the US government forced the lifting of the ban. In the same year the Sri Lankan government introduced a ban on imports of 21 categories of GMO food products and planned to enforce this ban under amendments to the Food Act. In response, the US warned the Sri Lankan government that it would take formal action in the WTO against the ban, risking US$190 million in sanctions. Worried that such sanctions would be applied to Sri Lankan garment exports to the US, the ban was lifted.

http://72.14.209.104/search?q=cache:adILVMYbmuEJ:www.greenpeace.org/raw/content/international/press/reports/the-us-war-on-biosafety-rene.pdf+%22gm+foods%22+%22forced+acceptance%22&hl=en&ct=clnk&cd=1&gl=us

[gravity]

135. No one is forcing anyone to use GM seeds

A farmer can choose the seeds they want, if GM one is less profitable, then the farmers would just use their old seeds.

[Gormy Cuss]

140. With due respect, all it would take to change that is more consolidation in seed production

Monsanto owns Seminis, a seed company that currently supplies 40% of domestic seed and 15-20% worldwide. There's one other large seed company that accounts for a large percentage and I'm blanking on the name. If the second company was also acquired by Monsanto or another GM producing entity, the bulk of the market would be held by corporations with a vested interest in offering their patented, probably terminator seed products because annual sales or license fees would be high. If as parent corp Monsanto uses a strategy of replacing existing varieties with their own patented GM versions, new farmers will no longer have much choice other than the GM products.

[NashVegas]

141. What Parts of "Forced Market" and "Trade Sanctions" Do You Not Understand?

By another name: extortion.

[femmedem]

161. Unless my memory fails me,

it is now illegal for Iraqi farmers to save their own seeds.

[Jcrowley]

180. This is correct

and the post you responded to is quite inaccurate. GMO's and GM seeds are assuredly being forced upon farmers through various mechanisms.

___________________________________________________________________________________________________________

The new patent law also explicitly promotes the commercialisation of genetically modified (GM) seeds in Iraq. Despite serious resistance from farmers and consumers around the world, these same companies are pushing GM crops on farmers around the world for their own profit. Contrary to what the industry is asserting, GM seeds do not reduce the use of pesticides, but they pose a threat to the environment and to people's health while they increase farmers dependency on agribusiness. In some countries like India, the 'accidental' release of GM crops is deliberately manipulated <6>, since physical segregation of GM and GM-free crops is not feasible. Once introduced into the agro-ecological cycle there is no possible recall or cleanup from genetic pollution <7>.

<snip>

RECONSTRUCTION FAÇADE

Iraq is one more arena in a global drive for the adoption of seed patent laws protecting the monopoly rights of multinational corporations at the expense of local farmers. Over the past decade, many countries of the South have been compelled <8> to adopt seed patent laws through bilateral treaties <9>. The US has pushed for UPOV-styled plant protection laws beyond the IPR standards of the WTO in bilateral trade through agreements for example with Sri Lanka <10> and Cambodia <11>. Likewise, post-conflict countries have been especially targeted. For instance, as part of its reconstruction package the US has recently signed a Trade and Investment Framework Agreement with Afghanistan <12>, which would also include IPR-related issues.

<snip>

Pushing for these "reforms" in Iraq has been the US Agency for International Development, which has been implementing an Agricultural Reconstruction and Development Program for Iraq (ARDI) since October 2003. To carry it out, a one-year US$5 million contract was granted to the US consulting firm Development Alternatives, Inc. <13> with the Texas A&M University <14> as an implementing partner. Part of the work has been sub-contracted to Sagric International <15> of Australia. The goal of ARDI in the name of rebuilding the farming sector is to develop the agribusiness opportunities and thus provide markets for agricultural products and services from overseas.

Reconstruction work, thus, is not necessarily about rebuilding domestic economies and capacities, but about helping corporations approved by the occupying forces to capitalise on market opportunities in Iraq. The legal framework laid down by Bremer ensures that although US troops may leave Iraq in the conceivable future, US domination of Iraq's economy is here to stay.

<snip>

Iraq has the potential to feed itself. But instead of developing this capacity, the US has shaped the future of Iraq's food and farming to serve the interests of US corporations. The new IPR regime pays scant respect to Iraqi farmers' contributions to the development of important crops like wheat, barley, date and pulses. Samples of such farmers' varieties were starting to be saved in the 1970s in the country's national gene bank in Abu Ghraib outside Baghdad. It is feared that all these have been lost in the long years of conflict. However, the Syria-based Consultative Group on International Agricultural Research (CGIAR) <17> centre - International Centre for Agricultural Research in Dry Areas (ICARDA) still holds accessions of several Iraqi varieties. These collections that are evidence of the Iraqi farmers' knowledge are supposed to be held in trust by the centre. These comprise the agricultural heritage of Iraq belonging to the Iraqi farmers that ought now to be repatriated. There have been situations where germplasm held by an international agricultural research centre has been "leaked out" for research and development to Northern scientists <18>. Such kind of "biopiracy" is fuelled by an IPR regime that ignores the prior art of the farmer and grants rights to a breeder who claims to have created something new from the material and knowledge of the very farmer.

http://www.grain.org/articles/?id=6

Go here to see the whole transcript on a pdf file:
http://www.grain.org/brl/?docid=977&lawid=1118

[Buzz Clik]

152. If a crop grows where none would grow before, that's an increase.

Any positive yield is greater than zero.

You seem to be locked into US programs only. You have a distinct lack of information.

[NashVegas]

188. Great. Why Don't You Try Growing the Stuff on the Moon

Where it will most assuredly grow where none would grow before, and it can't contaminate other crops in the public domain.

[Buzz Clik]

197. Sorry I missed this until now.

Your ignorance is truly amazing. You have no argument, so give it trying.

You are scared shitless of GMOs. So be it.

[Morgana LaFey]

124. I just read this headline to my DH

He screwed up his face, saying "uck," followed by, "I don't even want to hear it."

I couldn't agree more.

[Sequoia]

125. The Rice Man Cometh

[OneBlueSky]

129. it's not nice to fool Mother Nature . . . or to play God . . . n/t

.

[MonkeyFunk]

162. we've been doing it for many

thousands of years.

Do you know what "natural" corn is like? Or wheat? Or bananas? Or most other foods? '

We've engineered them to be what they are today.

Is it "Playing God" to eliminate smallpox? To give a diabetic insulin? To fill a cavity?

[Gidney N Cloyd]

132. Might go well with some fava beans and a nice chianti.

[OPERATIONMINDCRIME]

142. Cool! Sounds Like Some Beneficial Innovations Are On The Horizon. I Hope They're Successful!

[issac82_82]

145. Well, human genes are so tasty.

[Morgana LaFey]

153. Okay, here's what's wrong that this whole idea

from my perspective.

The ancient Chinese (Taoists) knew a lot about how the universe works, and their worldview was from within a completely different paradigm than the West. Their worldview is very different from ours, but not wrong. In fact, if offers many useful observations and truths for us to contemplate.

They described a world of yin and yang where eventually yin turns into yang and yang turns into yin. (Note: the Yin/Yang symbol includes a small seed of the other within each half, which symbolizes how nothing is 100% yin or yang; everything includes at least a little of the other.)

They also observed that while yang energy can be very beneficial -- imagine an uplifting song with a great beat playing that makes you want to dance. But too much yang is harmful. Imagine blaring music you can't turn off. We also need yin energy -- for example, restful, relaxing periods that include adequate sleep at night. Too much yin would be sleeping too much (usually due to a yin-type illness), and a general inability to rouse your energy to live your life fully. Too much yin is decay and stagnation.

BALANCE and harmony in all things, always, they cautioned. As have many other cultures. Extremes are dangerous and almost always harmful and destructive.

The same applies to the otherwise fine, wonderful, very yang qualities of reason, logic and rationality. Too much of a good thing in this sphere can be harmful and even destructive.

Human beings were given a head and the ability to think and reason, but we were also given a heart, with its ability to tune in to the subjective world -- our inspiration and creativity, a different kind of "common sense" that recognizes and respects the subjective, our inborn sense of the sacred, our inner guidance, our own human spirit, our connection to the collective unconscious, our connection to the Divine and the consciousness in all things, etc. There is always a great deal of violence involved in suppressing or eradicating or silencing this part of ourselves. Always.

Now consider -- or go back and re-read -- the posts from the two or three hyper-rational posters in this thread. How much respect have they shown anyone who disagrees with them, or doubts the wisdom (wisdom = another heart-based or right brain quality) of GMO crops? Their argumentation has been heavy-handed and even strong-arm. You are ridiculed if you don't buy into the hyper-rationality, if you have values (another right-brain, heart-based quality) which make this type of "product" unacceptable to you.

Logic isn't hte answer to everything; but they apparently believe it is and would shame or bully the rest of us into obeisance, if at all possible.

Make a mental note of who's posting what, and watch in the coming months and years what else they insist you "accept" in the name of "progress."

Oh, and about that starvation thing. It's a red herring. There is enough food to feed everyone on earth, it's merely a lack of political will combined with rampant corruption (usually, tho not always, in the 3rd world countries involved) that prevents the eradication of starvation.

Further, I have done some gardening myself. I understand a little about what goes into making it possible to produce food from the earth. I can't imagine very many places where it's literally "impossible" to grow at least a limited variety of foods that would prevent starvation. It might be necessary to amend the soil -- but that's usually required everywhere -- but organic, sustainable gardening and farming practices can create miracles, and have. And organic, btw, does NOT mean smaller harvests. Not at all.

So don't fall for all the corporate lies and dissembling, and don't fall for the strongarm tactics. There's a reason we are automatically repulsed by this type of "progress" -- it's because our hearts and intuition tell us it's a bad idea.

[Jcrowley]

155. That is so, so

fine.

Damn that's good. So very refreshing.

One day I'll relate to you my very long trials and trails in many discussions and debates with professors and corporate raiders who were pushing genetic engineering. Along the way I came to meet and befriend some amazing people Vandana Shiva, Luke Anderson, Kirkpatrick Sale, Brian Tokar among them and many others who are of no particular notoriety.

What you speak of really brings the discussion to another level. Mechanistic-reductionist thinking, a core aspect of the industrial modality of existence, not only destroys the earth in a physical sense but also destroys the great sense of mystery, a deep sense of wonder and imagination.

Gratitude.

:toast:

[Morgana LaFey]

166. Yes.

Thank you very much for your positive feedback. Thanks for your WORK as well. I'd very much like to hear more about it.

:hi:

[HiFructosePronSyrup]

160. Wow. You've blown my mind.

I've converted. You've convinced me.

Don't those stupid people in Southeast Asia and Africa know that if they just grow carrots, they'll stop going blind and dying of diarrhea? Don't they know there's enough food for everybody?

Clearly, they need to accept our lord and saviour Ramtha into their hearts.

[kiahzero]

173. New age crap.

Public policies require public justification. "Ick" isn't a justification. "It's scary" isn't a justification.

There's a reason we are automatically repulsed by this type of "progress"

Yes, but it's not a good one, and not everyone shares your "repulsion."

[LeftishBrit]

158. But human genes could never produce Rice!

To produce someone like Condi, you need to combine the genes of a dinosaur and a particularly venomous cobra.

[BlooInBloo]

167. How many human genes does rice ALREADY have?

They don't call it the tree of life for nuthin.

(It' probably be better to phrase it as: How many *rice* genes do *human* have, for chronological reasons.)


EDIT: "has", "have", whatever.

[HiFructosePronSyrup]

170. Carefully, now.

Rice is just as evolved as humans are.

We both share that common ancestor equally.

The first way you phrased it, is just as good as the latter.

[BlooInBloo]

174. That ancestor might have been rice. It certainly wasn't human. The 2nd is thus preferable.

[HiFructosePronSyrup]

175. The ancestor certainly wasn't rice, anymore than it was human.

You're making the common fallacy that evolution is a ladder, with humanity on the top.

It isn't so. Rice is just as "highly" evolved as humanity.

Rice can't build a computer, no. But you can't produce sugar out of sunlight either.

[BlooInBloo]

176. Then you know more about botanical history than I do.

EDIT: And I committed no fallacy of the sort you assert.

[HiFructosePronSyrup]

177. Simple biology.

They teach this stuff in high schools.

Well, good high schools anyway.

[Jcrowley]

189. GM Crops Failed

GM Crops Failed

"GM crops have higher yields, improved performances, and greatly reduce the use of agrochemicals. Farmers like them because they increase income." Lim Li Ching and Jonathan Matthews debunk these myths, documenting failures of GM crops around the world.

Lower yields

Thousands of controlled trials have shown significantly decreased yields with GM crops.

A study based on 8,200 trials of soya varieties in US universities in 1998 <1> reports yield drags between top RR varieties and top conventional varieties averaging 6.7%. In some areas, best conventional varieties produced yields on average 10% higher than RR varieties sold by the same seed companies.

In May 2000, results of a two-year study by Nebraska University’s Institute of Agriculture and Natural Resources showed RR soya yielded 6% less than their closest non-GM relatives and 11% less than high-yielding non-GM varieties <2>. The yield penalty was attributed to the gene insertion process.

Similar yield drags have been reported since 1997

<snip>

Yield drag in soya is associated with problems in root development, nodulation and nitrogen fixation, particularly in drought or infertile conditions, as the bacterial symbiont responsible for nitrogen fixation is sensitive to both Roundup and drought <9>. Furthermore, there is a metabolic cost to expressing herbicide-resistance or the Bt-endotoxin. For example, levels of proteins responsible for plant defence responses are depressed following Roundup application. Although these are eventually restored to normal, pathogens quickly infect the plants in sub-optimal growing conditions. This forces a diversion of energy to repair damage, resulting in an essentially irreversible tax on yields.

<snip>

Bt resistance and more pesticides

The other big claim for GM crops is reductions in pesticide use. In reality, herbicide tolerant and Bt-transgenic varieties of GM crops are trapping farmers into more reliance on pesticides.

Recently, hundreds of hectares of GM cotton fields in Bulukumba, South Sulawesi, were destroyed by pests <11>. Officials said that there was "nothing to worry about", and a spokesperson from Monsanto (the GM Bollgard cotton seed supplier) asserted that "they are just larva which eat the leaves, but will not disrupt cotton production". But local farmers complained, pointing out that the supplier had claimed the cotton variety was resistant to all kinds of pests.

What happens when GM crops fail to deliver on their promise of pest resistance? Farmers in Australia are now being advised to spray additional insecticide on Monsanto’s GM Bt cotton, INGARD, "under conditions of reduced INGARD plant efficacy" <12>. The latest official guidance <13> makes it clear that Bt cotton is in some circumstances failing to control the principal target pest it was introduced for, Helicoverpa armigera.

<snip>

Sustainable agriculture and organic farming are not a panacea. They however offer alternative approaches to GM technology that have been demonstrated to provide increased yields and more income, while remaining environmentally friendly. No myths about this.

Benbrook, C.M. (1999) ‘Evidence of the magnitude and consequences of the Roundup Ready soybean yield drag from university-based varietal trials in 1998’, Ag BioTech InfoNet Technical Paper Number 1, www.biotech-info.net/RR_yield_drag_98.pdf
University of Nebraska (2000) ‘Research shows Roundup Ready soybeans yield less’, IANR News Service,www.biotech-info.net/Roundup_soybeans_yield_less.html
See Griffiths, M. (1999) ‘The emperor’s transgenic clothes’, Are GMO lemmings in the US leading all of us over the biotechnology cliff? www.btinternet.com/~nlpwessex/Documents/gmlemmings.htm
See www.btinternet.com/~nlpwessex/Documents/wisconsinRRsoyatrials98.htm
Duffy, M. (1999) ‘1998 crop survey shows equal returns for GMO, non-GMO crops’, www.leopold.iastate.edu/news/9-22-99gmorel.html
Oplinger, E.S., M.J. Martinka, and K.A. Schmitz (1999) ‘Performance of transgenetic soybeans - Northern US’, presented to the ASTA Meetings, Chicago, cited in <8>.
Reported in Farmers Weekly (UK), 4th December 1998.
Clark, E.A. (1999) ‘10 reasons why farmers should think twice before growing GE crops’, www.plant.uoguelph.ca/faculty/eclark/10reasons.htm
Benbrook, C.M. (2001) ‘Troubled times amid commercial success for Roundup Ready soybeans: glyphosate efficacy is slipping and unstable transgene expression erodes plant defenses and yields’, Ag BioTech InfoNet Technical Paper Number 4, www.biotech-info.net/troubledtimes.html
'Economist: Biotech has not made impact yet', Farm Progress, 21 November 2000.
See the Jakarta Post.com, ‘Pests attack genetically modified cotton’, 29 June 2001, www.thejakartapost.com/yesterdaydetail.asp?fileid=20010629.A06
See www.biotech-info.net/Aussie_bt_cotton_problems.html
‘Resistance management plan for INGARD® Cotton 2001-2002’, Transgenic and Insect Management Strategy (TIMS) Committee of the Australian Cotton Growers Research Association, www.cotton.pi.csiro.au/Publicat/Pest/IRMS/irms0102.htm
See Thalmann, P. & V. Kung (2000) ‘No reduction of pesticides use with genetically engineered cotton’, for WWF International, www.biotech-info.net/WWF_inter_update.pdf; and Thalmann, P. & V. Kung (2000) ‘Transgenic cotton: Are there benefits for conservation? A case study of GMOs in agriculture, with special emphasis on freshwater’, www.panda.org/resources/publications/water/cotton/transgenic.html
Benbrook, C.M. (2001) ‘Do GM crops mean less pesticide use?’ Pesticide Outlook, October 2001.
Hall, L.M., J. Huffman, and K. Topinka (2000), ‘Pollen flow between herbicide tolerant canola (Brassica napus), Weed Science Society of America Abstracts 40: 48, http://www.mindfully.org/GE/Multiple-Resistant-Volunteers.htm
Westwood, J. (2001) ‘Cross-pollination leads to triple herbicide resistance’, ISB News Report March 2001, covering Agricultural and Environmental Biotechnology Developments, www.biotech-info.net/cross_pollination2.html
See Benbrook, C.M. (2001) 'When does it pay to plant Bt corn: farm-level economic impacts of Bt corn, 1996-2001', www.gefoodalert.org/library/admin/uploadedfiles/When_Does_It_Pay_To_Plant_Bt_Corn.pdf or http://www.biotech-info.net/Bt_corn_FF_final.pdf; press release from the Institute of Agriculture and Trade Policy (IATP), http://www.gefoodalert.org/library/admin/uploadedfiles/Benbrook_Bt_Press_Release.doc
See ‘Conventional vs. transgenic cotton’, edited by AgWeb.com Editors, 12/3/2001,
www.agweb.com/news_show_news_article.asp?articleID=81926&newscat=GN
Pretty, J. and R. Hine (2001) ‘Reducing food poverty with sustainable agriculture: a summary of new evidence’, Occasional Paper 2001-2, Centre for Environment and Society, University of Essex, www2.essex.ac.uk/ces/ResearchProgrammes/CESOccasionalPapers/SAFErepSUBHEADS.htm
Pearce, F. (2001) ‘An ordinary miracle’, New Scientist, Vol. 169, Issue 2276, p. 16, 3 February 2001.
Brough, D. (2001) ‘FAO urges poor nations to boost organic food sales’, Reuters, 4 December 2001, www.planetark.org/dailynewsstory.cfm/newsid/13562/story.ht

I await a detailed response.

[PhilipShore]

172. Bush's Frankenfood

[lovuian]

178. Cannabilism isn't good it causes things like Mad Cow

its creepy too

[HiFructosePronSyrup]

179. LOL.

That's like saying gay sex causes AIDS.

Mad Cow it's caused by cannabilism, it's spread via cannabilism, specifically via eating nerve tissue.

And this isn't cannabilism. Drinking breast milk is more cannabilistic than this.

[goforit]

183. Sales in Granola and Yogurt and rice will plummet!!!

[goforit]

184. MONSANTO SUCKS!!!!!!!!!!!!!!!!

:argh:

[JCMach1]

190. Soylent Green is people

or something like that!